ID: 1123053289

View in Genome Browser
Species Human (GRCh38)
Location 14:105557914-105557936
Sequence GCCTCCGCGGGGCTGCGCTC GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1123053282_1123053289 -2 Left 1123053282 14:105557893-105557915 CCTTGTGGGAGCCTCGGTCCAGC No data
Right 1123053289 14:105557914-105557936 GCCTCCGCGGGGCTGCGCTCGGG No data
1123053277_1123053289 16 Left 1123053277 14:105557875-105557897 CCTTTGGGCAGAAGAAGCCCTTG No data
Right 1123053289 14:105557914-105557936 GCCTCCGCGGGGCTGCGCTCGGG No data
1123053281_1123053289 -1 Left 1123053281 14:105557892-105557914 CCCTTGTGGGAGCCTCGGTCCAG No data
Right 1123053289 14:105557914-105557936 GCCTCCGCGGGGCTGCGCTCGGG No data
1123053276_1123053289 30 Left 1123053276 14:105557861-105557883 CCGACTCTGTTTCTCCTTTGGGC No data
Right 1123053289 14:105557914-105557936 GCCTCCGCGGGGCTGCGCTCGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1123053289 Original CRISPR GCCTCCGCGGGGCTGCGCTC GGG Intergenic