ID: 1123053292

View in Genome Browser
Species Human (GRCh38)
Location 14:105557918-105557940
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1123053286_1123053292 -9 Left 1123053286 14:105557904-105557926 CCTCGGTCCAGCCTCCGCGGGGC No data
Right 1123053292 14:105557918-105557940 CCGCGGGGCTGCGCTCGGGCTGG No data
1123053282_1123053292 2 Left 1123053282 14:105557893-105557915 CCTTGTGGGAGCCTCGGTCCAGC No data
Right 1123053292 14:105557918-105557940 CCGCGGGGCTGCGCTCGGGCTGG No data
1123053281_1123053292 3 Left 1123053281 14:105557892-105557914 CCCTTGTGGGAGCCTCGGTCCAG No data
Right 1123053292 14:105557918-105557940 CCGCGGGGCTGCGCTCGGGCTGG No data
1123053277_1123053292 20 Left 1123053277 14:105557875-105557897 CCTTTGGGCAGAAGAAGCCCTTG No data
Right 1123053292 14:105557918-105557940 CCGCGGGGCTGCGCTCGGGCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1123053292 Original CRISPR CCGCGGGGCTGCGCTCGGGC TGG Intergenic