ID: 1123053293

View in Genome Browser
Species Human (GRCh38)
Location 14:105557919-105557941
Sequence CGCGGGGCTGCGCTCGGGCT GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1123053282_1123053293 3 Left 1123053282 14:105557893-105557915 CCTTGTGGGAGCCTCGGTCCAGC No data
Right 1123053293 14:105557919-105557941 CGCGGGGCTGCGCTCGGGCTGGG No data
1123053286_1123053293 -8 Left 1123053286 14:105557904-105557926 CCTCGGTCCAGCCTCCGCGGGGC No data
Right 1123053293 14:105557919-105557941 CGCGGGGCTGCGCTCGGGCTGGG No data
1123053277_1123053293 21 Left 1123053277 14:105557875-105557897 CCTTTGGGCAGAAGAAGCCCTTG No data
Right 1123053293 14:105557919-105557941 CGCGGGGCTGCGCTCGGGCTGGG No data
1123053281_1123053293 4 Left 1123053281 14:105557892-105557914 CCCTTGTGGGAGCCTCGGTCCAG No data
Right 1123053293 14:105557919-105557941 CGCGGGGCTGCGCTCGGGCTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1123053293 Original CRISPR CGCGGGGCTGCGCTCGGGCT GGG Intergenic