ID: 1123053294

View in Genome Browser
Species Human (GRCh38)
Location 14:105557922-105557944
Sequence GGGGCTGCGCTCGGGCTGGG TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1123053281_1123053294 7 Left 1123053281 14:105557892-105557914 CCCTTGTGGGAGCCTCGGTCCAG No data
Right 1123053294 14:105557922-105557944 GGGGCTGCGCTCGGGCTGGGTGG No data
1123053286_1123053294 -5 Left 1123053286 14:105557904-105557926 CCTCGGTCCAGCCTCCGCGGGGC No data
Right 1123053294 14:105557922-105557944 GGGGCTGCGCTCGGGCTGGGTGG No data
1123053277_1123053294 24 Left 1123053277 14:105557875-105557897 CCTTTGGGCAGAAGAAGCCCTTG No data
Right 1123053294 14:105557922-105557944 GGGGCTGCGCTCGGGCTGGGTGG No data
1123053282_1123053294 6 Left 1123053282 14:105557893-105557915 CCTTGTGGGAGCCTCGGTCCAGC No data
Right 1123053294 14:105557922-105557944 GGGGCTGCGCTCGGGCTGGGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1123053294 Original CRISPR GGGGCTGCGCTCGGGCTGGG TGG Intergenic