ID: 1123053295

View in Genome Browser
Species Human (GRCh38)
Location 14:105557943-105557965
Sequence GGCGTCTCCTGCTCTTTCTT CGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1123053290_1123053295 5 Left 1123053290 14:105557915-105557937 CCTCCGCGGGGCTGCGCTCGGGC No data
Right 1123053295 14:105557943-105557965 GGCGTCTCCTGCTCTTTCTTCGG No data
1123053291_1123053295 2 Left 1123053291 14:105557918-105557940 CCGCGGGGCTGCGCTCGGGCTGG No data
Right 1123053295 14:105557943-105557965 GGCGTCTCCTGCTCTTTCTTCGG No data
1123053281_1123053295 28 Left 1123053281 14:105557892-105557914 CCCTTGTGGGAGCCTCGGTCCAG No data
Right 1123053295 14:105557943-105557965 GGCGTCTCCTGCTCTTTCTTCGG No data
1123053282_1123053295 27 Left 1123053282 14:105557893-105557915 CCTTGTGGGAGCCTCGGTCCAGC No data
Right 1123053295 14:105557943-105557965 GGCGTCTCCTGCTCTTTCTTCGG No data
1123053287_1123053295 9 Left 1123053287 14:105557911-105557933 CCAGCCTCCGCGGGGCTGCGCTC No data
Right 1123053295 14:105557943-105557965 GGCGTCTCCTGCTCTTTCTTCGG No data
1123053286_1123053295 16 Left 1123053286 14:105557904-105557926 CCTCGGTCCAGCCTCCGCGGGGC No data
Right 1123053295 14:105557943-105557965 GGCGTCTCCTGCTCTTTCTTCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1123053295 Original CRISPR GGCGTCTCCTGCTCTTTCTT CGG Intergenic