ID: 1123054500

View in Genome Browser
Species Human (GRCh38)
Location 14:105562596-105562618
Sequence GCCACCACACCCTGCGGATC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1123054500_1123054511 22 Left 1123054500 14:105562596-105562618 CCTGATCCGCAGGGTGTGGTGGC No data
Right 1123054511 14:105562641-105562663 GACTGCAGGCAAGCTGTCAAGGG No data
1123054500_1123054510 21 Left 1123054500 14:105562596-105562618 CCTGATCCGCAGGGTGTGGTGGC No data
Right 1123054510 14:105562640-105562662 AGACTGCAGGCAAGCTGTCAAGG No data
1123054500_1123054506 8 Left 1123054500 14:105562596-105562618 CCTGATCCGCAGGGTGTGGTGGC No data
Right 1123054506 14:105562627-105562649 GGACCCCTCTGACAGACTGCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1123054500 Original CRISPR GCCACCACACCCTGCGGATC AGG (reversed) Intergenic