ID: 1123054501

View in Genome Browser
Species Human (GRCh38)
Location 14:105562602-105562624
Sequence CAGAGGGCCACCACACCCTG CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1123054501_1123054510 15 Left 1123054501 14:105562602-105562624 CCGCAGGGTGTGGTGGCCCTCTG No data
Right 1123054510 14:105562640-105562662 AGACTGCAGGCAAGCTGTCAAGG No data
1123054501_1123054506 2 Left 1123054501 14:105562602-105562624 CCGCAGGGTGTGGTGGCCCTCTG No data
Right 1123054506 14:105562627-105562649 GGACCCCTCTGACAGACTGCAGG No data
1123054501_1123054511 16 Left 1123054501 14:105562602-105562624 CCGCAGGGTGTGGTGGCCCTCTG No data
Right 1123054511 14:105562641-105562663 GACTGCAGGCAAGCTGTCAAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1123054501 Original CRISPR CAGAGGGCCACCACACCCTG CGG (reversed) Intergenic