ID: 1123054504

View in Genome Browser
Species Human (GRCh38)
Location 14:105562618-105562640
Sequence TGTCAGAGGGGTCCCTCAGA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1123054504_1123054511 0 Left 1123054504 14:105562618-105562640 CCCTCTGAGGGACCCCTCTGACA No data
Right 1123054511 14:105562641-105562663 GACTGCAGGCAAGCTGTCAAGGG No data
1123054504_1123054513 16 Left 1123054504 14:105562618-105562640 CCCTCTGAGGGACCCCTCTGACA No data
Right 1123054513 14:105562657-105562679 TCAAGGGTGTGTGTGTCTGAGGG No data
1123054504_1123054510 -1 Left 1123054504 14:105562618-105562640 CCCTCTGAGGGACCCCTCTGACA No data
Right 1123054510 14:105562640-105562662 AGACTGCAGGCAAGCTGTCAAGG No data
1123054504_1123054512 15 Left 1123054504 14:105562618-105562640 CCCTCTGAGGGACCCCTCTGACA No data
Right 1123054512 14:105562656-105562678 GTCAAGGGTGTGTGTGTCTGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1123054504 Original CRISPR TGTCAGAGGGGTCCCTCAGA GGG (reversed) Intergenic