ID: 1123054505

View in Genome Browser
Species Human (GRCh38)
Location 14:105562619-105562641
Sequence CTGTCAGAGGGGTCCCTCAG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1123054505_1123054512 14 Left 1123054505 14:105562619-105562641 CCTCTGAGGGACCCCTCTGACAG No data
Right 1123054512 14:105562656-105562678 GTCAAGGGTGTGTGTGTCTGAGG No data
1123054505_1123054510 -2 Left 1123054505 14:105562619-105562641 CCTCTGAGGGACCCCTCTGACAG No data
Right 1123054510 14:105562640-105562662 AGACTGCAGGCAAGCTGTCAAGG No data
1123054505_1123054513 15 Left 1123054505 14:105562619-105562641 CCTCTGAGGGACCCCTCTGACAG No data
Right 1123054513 14:105562657-105562679 TCAAGGGTGTGTGTGTCTGAGGG No data
1123054505_1123054511 -1 Left 1123054505 14:105562619-105562641 CCTCTGAGGGACCCCTCTGACAG No data
Right 1123054511 14:105562641-105562663 GACTGCAGGCAAGCTGTCAAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1123054505 Original CRISPR CTGTCAGAGGGGTCCCTCAG AGG (reversed) Intergenic
No off target data available for this crispr