ID: 1123054506 |
View in Genome Browser |
| Species | Human (GRCh38) |
| Location | 14:105562627-105562649 |
| Sequence | GGACCCCTCTGACAGACTGC AGG |
| Strand | + |
| Crispr in exon? | No |
| Crispr in intron? | No |
| Off-Target Counts | All | Exonic | Intronic | Intergenic |
|---|---|---|---|---|
| Total | ||||
| Summary |
Found 2 Related Crispr Pairs
Show Crispr Pairs| ID | Spacer | Status | Summary | ID | Location | Sequence | Summary | |
|---|---|---|---|---|---|---|---|---|
| 1123054501_1123054506 | 2 | Left | 1123054501 | 14:105562602-105562624 | CCGCAGGGTGTGGTGGCCCTCTG | No data | ||
| Right | 1123054506 | 14:105562627-105562649 | GGACCCCTCTGACAGACTGCAGG | No data | ||||
| 1123054500_1123054506 | 8 | Left | 1123054500 | 14:105562596-105562618 | CCTGATCCGCAGGGTGTGGTGGC | No data | ||
| Right | 1123054506 | 14:105562627-105562649 | GGACCCCTCTGACAGACTGCAGG | No data |
Note: the row highlighted in blue is the original CRISPR
| WGE ID | Location | Sequence | Mismatches | Strand | Type |
|---|---|---|---|---|---|
| 1123054506 | Original CRISPR | GGACCCCTCTGACAGACTGC AGG | Intergenic | ||