ID: 1123054506

View in Genome Browser
Species Human (GRCh38)
Location 14:105562627-105562649
Sequence GGACCCCTCTGACAGACTGC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1123054501_1123054506 2 Left 1123054501 14:105562602-105562624 CCGCAGGGTGTGGTGGCCCTCTG No data
Right 1123054506 14:105562627-105562649 GGACCCCTCTGACAGACTGCAGG No data
1123054500_1123054506 8 Left 1123054500 14:105562596-105562618 CCTGATCCGCAGGGTGTGGTGGC No data
Right 1123054506 14:105562627-105562649 GGACCCCTCTGACAGACTGCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1123054506 Original CRISPR GGACCCCTCTGACAGACTGC AGG Intergenic