ID: 1123054510

View in Genome Browser
Species Human (GRCh38)
Location 14:105562640-105562662
Sequence AGACTGCAGGCAAGCTGTCA AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1123054501_1123054510 15 Left 1123054501 14:105562602-105562624 CCGCAGGGTGTGGTGGCCCTCTG No data
Right 1123054510 14:105562640-105562662 AGACTGCAGGCAAGCTGTCAAGG No data
1123054500_1123054510 21 Left 1123054500 14:105562596-105562618 CCTGATCCGCAGGGTGTGGTGGC No data
Right 1123054510 14:105562640-105562662 AGACTGCAGGCAAGCTGTCAAGG No data
1123054504_1123054510 -1 Left 1123054504 14:105562618-105562640 CCCTCTGAGGGACCCCTCTGACA No data
Right 1123054510 14:105562640-105562662 AGACTGCAGGCAAGCTGTCAAGG No data
1123054505_1123054510 -2 Left 1123054505 14:105562619-105562641 CCTCTGAGGGACCCCTCTGACAG No data
Right 1123054510 14:105562640-105562662 AGACTGCAGGCAAGCTGTCAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1123054510 Original CRISPR AGACTGCAGGCAAGCTGTCA AGG Intergenic