ID: 1123054513

View in Genome Browser
Species Human (GRCh38)
Location 14:105562657-105562679
Sequence TCAAGGGTGTGTGTGTCTGA GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1123054507_1123054513 4 Left 1123054507 14:105562630-105562652 CCCCTCTGACAGACTGCAGGCAA No data
Right 1123054513 14:105562657-105562679 TCAAGGGTGTGTGTGTCTGAGGG No data
1123054509_1123054513 2 Left 1123054509 14:105562632-105562654 CCTCTGACAGACTGCAGGCAAGC No data
Right 1123054513 14:105562657-105562679 TCAAGGGTGTGTGTGTCTGAGGG No data
1123054505_1123054513 15 Left 1123054505 14:105562619-105562641 CCTCTGAGGGACCCCTCTGACAG No data
Right 1123054513 14:105562657-105562679 TCAAGGGTGTGTGTGTCTGAGGG No data
1123054504_1123054513 16 Left 1123054504 14:105562618-105562640 CCCTCTGAGGGACCCCTCTGACA No data
Right 1123054513 14:105562657-105562679 TCAAGGGTGTGTGTGTCTGAGGG No data
1123054508_1123054513 3 Left 1123054508 14:105562631-105562653 CCCTCTGACAGACTGCAGGCAAG No data
Right 1123054513 14:105562657-105562679 TCAAGGGTGTGTGTGTCTGAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1123054513 Original CRISPR TCAAGGGTGTGTGTGTCTGA GGG Intergenic