ID: 1123056377

View in Genome Browser
Species Human (GRCh38)
Location 14:105572545-105572567
Sequence CCTCCCTCGCTGGGGCTGGA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1123056377_1123056388 -4 Left 1123056377 14:105572545-105572567 CCCTCCAGCCCCAGCGAGGGAGG No data
Right 1123056388 14:105572564-105572586 GAGGCTGGGCCCCGGGCAGCAGG No data
1123056377_1123056395 11 Left 1123056377 14:105572545-105572567 CCCTCCAGCCCCAGCGAGGGAGG No data
Right 1123056395 14:105572579-105572601 GCAGCAGGTGGTGAGGGCAGCGG No data
1123056377_1123056392 5 Left 1123056377 14:105572545-105572567 CCCTCCAGCCCCAGCGAGGGAGG No data
Right 1123056392 14:105572573-105572595 CCCCGGGCAGCAGGTGGTGAGGG No data
1123056377_1123056390 4 Left 1123056377 14:105572545-105572567 CCCTCCAGCCCCAGCGAGGGAGG No data
Right 1123056390 14:105572572-105572594 GCCCCGGGCAGCAGGTGGTGAGG No data
1123056377_1123056389 -1 Left 1123056377 14:105572545-105572567 CCCTCCAGCCCCAGCGAGGGAGG No data
Right 1123056389 14:105572567-105572589 GCTGGGCCCCGGGCAGCAGGTGG No data
1123056377_1123056396 12 Left 1123056377 14:105572545-105572567 CCCTCCAGCCCCAGCGAGGGAGG No data
Right 1123056396 14:105572580-105572602 CAGCAGGTGGTGAGGGCAGCGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1123056377 Original CRISPR CCTCCCTCGCTGGGGCTGGA GGG (reversed) Intergenic
No off target data available for this crispr