ID: 1123057151

View in Genome Browser
Species Human (GRCh38)
Location 14:105575916-105575938
Sequence CTGAGGTTACATGGTGATGG GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1123057136_1123057151 26 Left 1123057136 14:105575867-105575889 CCCACTGTACAGAGAGAACACTG No data
Right 1123057151 14:105575916-105575938 CTGAGGTTACATGGTGATGGGGG No data
1123057137_1123057151 25 Left 1123057137 14:105575868-105575890 CCACTGTACAGAGAGAACACTGA No data
Right 1123057151 14:105575916-105575938 CTGAGGTTACATGGTGATGGGGG No data
1123057135_1123057151 27 Left 1123057135 14:105575866-105575888 CCCCACTGTACAGAGAGAACACT No data
Right 1123057151 14:105575916-105575938 CTGAGGTTACATGGTGATGGGGG No data
1123057145_1123057151 -10 Left 1123057145 14:105575903-105575925 CCAGGGACATGGCCTGAGGTTAC No data
Right 1123057151 14:105575916-105575938 CTGAGGTTACATGGTGATGGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1123057151 Original CRISPR CTGAGGTTACATGGTGATGG GGG Intergenic
No off target data available for this crispr