ID: 1123057177

View in Genome Browser
Species Human (GRCh38)
Location 14:105576023-105576045
Sequence CTGGAGGCTCAGATGGAGAC GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1123057177_1123057183 7 Left 1123057177 14:105576023-105576045 CCCGTCTCCATCTGAGCCTCCAG No data
Right 1123057183 14:105576053-105576075 TTTCCCGCTGTCCCTGTCTCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1123057177 Original CRISPR CTGGAGGCTCAGATGGAGAC GGG (reversed) Intergenic
No off target data available for this crispr