ID: 1123057554

View in Genome Browser
Species Human (GRCh38)
Location 14:105579262-105579284
Sequence CCTCCCTCGCTGGGGCTGGA GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1123057541_1123057554 4 Left 1123057541 14:105579235-105579257 CCTCACCACCTGCTGCCCGGGGC No data
Right 1123057554 14:105579262-105579284 CCTCCCTCGCTGGGGCTGGAGGG No data
1123057539_1123057554 5 Left 1123057539 14:105579234-105579256 CCCTCACCACCTGCTGCCCGGGG No data
Right 1123057554 14:105579262-105579284 CCTCCCTCGCTGGGGCTGGAGGG No data
1123057542_1123057554 -1 Left 1123057542 14:105579240-105579262 CCACCTGCTGCCCGGGGCCCAGC No data
Right 1123057554 14:105579262-105579284 CCTCCCTCGCTGGGGCTGGAGGG No data
1123057536_1123057554 11 Left 1123057536 14:105579228-105579250 CCGCTGCCCTCACCACCTGCTGC No data
Right 1123057554 14:105579262-105579284 CCTCCCTCGCTGGGGCTGGAGGG No data
1123057543_1123057554 -4 Left 1123057543 14:105579243-105579265 CCTGCTGCCCGGGGCCCAGCCTC No data
Right 1123057554 14:105579262-105579284 CCTCCCTCGCTGGGGCTGGAGGG No data
1123057535_1123057554 12 Left 1123057535 14:105579227-105579249 CCCGCTGCCCTCACCACCTGCTG No data
Right 1123057554 14:105579262-105579284 CCTCCCTCGCTGGGGCTGGAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1123057554 Original CRISPR CCTCCCTCGCTGGGGCTGGA GGG Intergenic
No off target data available for this crispr