ID: 1123059636

View in Genome Browser
Species Human (GRCh38)
Location 14:105588692-105588714
Sequence CCAGTTCCTGCTCTGGGTGG GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1123059624_1123059636 -6 Left 1123059624 14:105588675-105588697 CCCTGAGCTCCCTGACCCCAGTT No data
Right 1123059636 14:105588692-105588714 CCAGTTCCTGCTCTGGGTGGGGG No data
1123059623_1123059636 -5 Left 1123059623 14:105588674-105588696 CCCCTGAGCTCCCTGACCCCAGT No data
Right 1123059636 14:105588692-105588714 CCAGTTCCTGCTCTGGGTGGGGG No data
1123059622_1123059636 12 Left 1123059622 14:105588657-105588679 CCATGGAGTGGCTGAGTCCCCTG No data
Right 1123059636 14:105588692-105588714 CCAGTTCCTGCTCTGGGTGGGGG No data
1123059625_1123059636 -7 Left 1123059625 14:105588676-105588698 CCTGAGCTCCCTGACCCCAGTTC No data
Right 1123059636 14:105588692-105588714 CCAGTTCCTGCTCTGGGTGGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1123059636 Original CRISPR CCAGTTCCTGCTCTGGGTGG GGG Intergenic
No off target data available for this crispr