ID: 1123061366

View in Genome Browser
Species Human (GRCh38)
Location 14:105596193-105596215
Sequence CTGGGGCCCCAGAGCCATCG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1123061366_1123061379 18 Left 1123061366 14:105596193-105596215 CCCCGATGGCTCTGGGGCCCCAG No data
Right 1123061379 14:105596234-105596256 CTCAGCTCTTCAGGAGGTCCAGG No data
1123061366_1123061377 12 Left 1123061366 14:105596193-105596215 CCCCGATGGCTCTGGGGCCCCAG No data
Right 1123061377 14:105596228-105596250 TCACCTCTCAGCTCTTCAGGAGG No data
1123061366_1123061381 25 Left 1123061366 14:105596193-105596215 CCCCGATGGCTCTGGGGCCCCAG No data
Right 1123061381 14:105596241-105596263 CTTCAGGAGGTCCAGGCTGGTGG No data
1123061366_1123061383 29 Left 1123061366 14:105596193-105596215 CCCCGATGGCTCTGGGGCCCCAG No data
Right 1123061383 14:105596245-105596267 AGGAGGTCCAGGCTGGTGGGCGG No data
1123061366_1123061382 26 Left 1123061366 14:105596193-105596215 CCCCGATGGCTCTGGGGCCCCAG No data
Right 1123061382 14:105596242-105596264 TTCAGGAGGTCCAGGCTGGTGGG No data
1123061366_1123061380 22 Left 1123061366 14:105596193-105596215 CCCCGATGGCTCTGGGGCCCCAG No data
Right 1123061380 14:105596238-105596260 GCTCTTCAGGAGGTCCAGGCTGG No data
1123061366_1123061376 9 Left 1123061366 14:105596193-105596215 CCCCGATGGCTCTGGGGCCCCAG No data
Right 1123061376 14:105596225-105596247 GGGTCACCTCTCAGCTCTTCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1123061366 Original CRISPR CTGGGGCCCCAGAGCCATCG GGG (reversed) Intergenic
No off target data available for this crispr