ID: 1123061735

View in Genome Browser
Species Human (GRCh38)
Location 14:105597625-105597647
Sequence CCAGCGCCTGAGCCTCCCTC GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1123061735_1123061738 -8 Left 1123061735 14:105597625-105597647 CCCGAGGGAGGCTCAGGCGCTGG No data
Right 1123061738 14:105597640-105597662 GGCGCTGGCAGAGAAAAAGCTGG No data
1123061735_1123061744 19 Left 1123061735 14:105597625-105597647 CCCGAGGGAGGCTCAGGCGCTGG No data
Right 1123061744 14:105597667-105597689 GGTGGAGCGTGAGTGGCCCGCGG No data
1123061735_1123061739 -7 Left 1123061735 14:105597625-105597647 CCCGAGGGAGGCTCAGGCGCTGG No data
Right 1123061739 14:105597641-105597663 GCGCTGGCAGAGAAAAAGCTGGG No data
1123061735_1123061740 -2 Left 1123061735 14:105597625-105597647 CCCGAGGGAGGCTCAGGCGCTGG No data
Right 1123061740 14:105597646-105597668 GGCAGAGAAAAAGCTGGGCCTGG No data
1123061735_1123061746 30 Left 1123061735 14:105597625-105597647 CCCGAGGGAGGCTCAGGCGCTGG No data
Right 1123061746 14:105597678-105597700 AGTGGCCCGCGGCCTAGGCGTGG No data
1123061735_1123061745 25 Left 1123061735 14:105597625-105597647 CCCGAGGGAGGCTCAGGCGCTGG No data
Right 1123061745 14:105597673-105597695 GCGTGAGTGGCCCGCGGCCTAGG No data
1123061735_1123061741 1 Left 1123061735 14:105597625-105597647 CCCGAGGGAGGCTCAGGCGCTGG No data
Right 1123061741 14:105597649-105597671 AGAGAAAAAGCTGGGCCTGGTGG No data
1123061735_1123061742 12 Left 1123061735 14:105597625-105597647 CCCGAGGGAGGCTCAGGCGCTGG No data
Right 1123061742 14:105597660-105597682 TGGGCCTGGTGGAGCGTGAGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1123061735 Original CRISPR CCAGCGCCTGAGCCTCCCTC GGG (reversed) Intergenic