ID: 1123061738

View in Genome Browser
Species Human (GRCh38)
Location 14:105597640-105597662
Sequence GGCGCTGGCAGAGAAAAAGC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1123061728_1123061738 12 Left 1123061728 14:105597605-105597627 CCACCCAGGGCAGGGCGCAGCCC No data
Right 1123061738 14:105597640-105597662 GGCGCTGGCAGAGAAAAAGCTGG No data
1123061724_1123061738 20 Left 1123061724 14:105597597-105597619 CCCTTTTCCCACCCAGGGCAGGG No data
Right 1123061738 14:105597640-105597662 GGCGCTGGCAGAGAAAAAGCTGG No data
1123061726_1123061738 19 Left 1123061726 14:105597598-105597620 CCTTTTCCCACCCAGGGCAGGGC No data
Right 1123061738 14:105597640-105597662 GGCGCTGGCAGAGAAAAAGCTGG No data
1123061737_1123061738 -9 Left 1123061737 14:105597626-105597648 CCGAGGGAGGCTCAGGCGCTGGC No data
Right 1123061738 14:105597640-105597662 GGCGCTGGCAGAGAAAAAGCTGG No data
1123061735_1123061738 -8 Left 1123061735 14:105597625-105597647 CCCGAGGGAGGCTCAGGCGCTGG No data
Right 1123061738 14:105597640-105597662 GGCGCTGGCAGAGAAAAAGCTGG No data
1123061729_1123061738 9 Left 1123061729 14:105597608-105597630 CCCAGGGCAGGGCGCAGCCCGAG No data
Right 1123061738 14:105597640-105597662 GGCGCTGGCAGAGAAAAAGCTGG No data
1123061727_1123061738 13 Left 1123061727 14:105597604-105597626 CCCACCCAGGGCAGGGCGCAGCC No data
Right 1123061738 14:105597640-105597662 GGCGCTGGCAGAGAAAAAGCTGG No data
1123061730_1123061738 8 Left 1123061730 14:105597609-105597631 CCAGGGCAGGGCGCAGCCCGAGG No data
Right 1123061738 14:105597640-105597662 GGCGCTGGCAGAGAAAAAGCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1123061738 Original CRISPR GGCGCTGGCAGAGAAAAAGC TGG Intergenic