ID: 1123061742

View in Genome Browser
Species Human (GRCh38)
Location 14:105597660-105597682
Sequence TGGGCCTGGTGGAGCGTGAG TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1123061730_1123061742 28 Left 1123061730 14:105597609-105597631 CCAGGGCAGGGCGCAGCCCGAGG No data
Right 1123061742 14:105597660-105597682 TGGGCCTGGTGGAGCGTGAGTGG No data
1123061737_1123061742 11 Left 1123061737 14:105597626-105597648 CCGAGGGAGGCTCAGGCGCTGGC No data
Right 1123061742 14:105597660-105597682 TGGGCCTGGTGGAGCGTGAGTGG No data
1123061729_1123061742 29 Left 1123061729 14:105597608-105597630 CCCAGGGCAGGGCGCAGCCCGAG No data
Right 1123061742 14:105597660-105597682 TGGGCCTGGTGGAGCGTGAGTGG No data
1123061735_1123061742 12 Left 1123061735 14:105597625-105597647 CCCGAGGGAGGCTCAGGCGCTGG No data
Right 1123061742 14:105597660-105597682 TGGGCCTGGTGGAGCGTGAGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1123061742 Original CRISPR TGGGCCTGGTGGAGCGTGAG TGG Intergenic