ID: 1123061745

View in Genome Browser
Species Human (GRCh38)
Location 14:105597673-105597695
Sequence GCGTGAGTGGCCCGCGGCCT AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1123061737_1123061745 24 Left 1123061737 14:105597626-105597648 CCGAGGGAGGCTCAGGCGCTGGC No data
Right 1123061745 14:105597673-105597695 GCGTGAGTGGCCCGCGGCCTAGG No data
1123061735_1123061745 25 Left 1123061735 14:105597625-105597647 CCCGAGGGAGGCTCAGGCGCTGG No data
Right 1123061745 14:105597673-105597695 GCGTGAGTGGCCCGCGGCCTAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1123061745 Original CRISPR GCGTGAGTGGCCCGCGGCCT AGG Intergenic