ID: 1123061746

View in Genome Browser
Species Human (GRCh38)
Location 14:105597678-105597700
Sequence AGTGGCCCGCGGCCTAGGCG TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1123061735_1123061746 30 Left 1123061735 14:105597625-105597647 CCCGAGGGAGGCTCAGGCGCTGG No data
Right 1123061746 14:105597678-105597700 AGTGGCCCGCGGCCTAGGCGTGG No data
1123061743_1123061746 -9 Left 1123061743 14:105597664-105597686 CCTGGTGGAGCGTGAGTGGCCCG No data
Right 1123061746 14:105597678-105597700 AGTGGCCCGCGGCCTAGGCGTGG No data
1123061737_1123061746 29 Left 1123061737 14:105597626-105597648 CCGAGGGAGGCTCAGGCGCTGGC No data
Right 1123061746 14:105597678-105597700 AGTGGCCCGCGGCCTAGGCGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1123061746 Original CRISPR AGTGGCCCGCGGCCTAGGCG TGG Intergenic