ID: 1123061870

View in Genome Browser
Species Human (GRCh38)
Location 14:105598135-105598157
Sequence GACCTGGGTGCCCACCCTCA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1123061870_1123061877 5 Left 1123061870 14:105598135-105598157 CCCTGAGGGTGGGCACCCAGGTC No data
Right 1123061877 14:105598163-105598185 TCAGTCAACGGCCCAGAGCCAGG No data
1123061870_1123061874 -7 Left 1123061870 14:105598135-105598157 CCCTGAGGGTGGGCACCCAGGTC No data
Right 1123061874 14:105598151-105598173 CCAGGTCCCGAGTCAGTCAACGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1123061870 Original CRISPR GACCTGGGTGCCCACCCTCA GGG (reversed) Intergenic
No off target data available for this crispr