ID: 1123062335

View in Genome Browser
Species Human (GRCh38)
Location 14:105599905-105599927
Sequence CCCTGCCCGCTCCCAAGAAT GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 120
Summary {0: 1, 1: 1, 2: 0, 3: 3, 4: 115}

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1123062325_1123062335 21 Left 1123062325 14:105599861-105599883 CCTGGGGGGCCCATTCCTCTGTG No data
Right 1123062335 14:105599905-105599927 CCCTGCCCGCTCCCAAGAATGGG 0: 1
1: 1
2: 0
3: 3
4: 115
1123062324_1123062335 24 Left 1123062324 14:105599858-105599880 CCTCCTGGGGGGCCCATTCCTCT No data
Right 1123062335 14:105599905-105599927 CCCTGCCCGCTCCCAAGAATGGG 0: 1
1: 1
2: 0
3: 3
4: 115
1123062328_1123062335 6 Left 1123062328 14:105599876-105599898 CCTCTGTGCCAAGATGCACCTGC No data
Right 1123062335 14:105599905-105599927 CCCTGCCCGCTCCCAAGAATGGG 0: 1
1: 1
2: 0
3: 3
4: 115
1123062329_1123062335 -2 Left 1123062329 14:105599884-105599906 CCAAGATGCACCTGCCCACAGCC 0: 3
1: 0
2: 3
3: 31
4: 332
Right 1123062335 14:105599905-105599927 CCCTGCCCGCTCCCAAGAATGGG 0: 1
1: 1
2: 0
3: 3
4: 115
1123062322_1123062335 26 Left 1123062322 14:105599856-105599878 CCCCTCCTGGGGGGCCCATTCCT No data
Right 1123062335 14:105599905-105599927 CCCTGCCCGCTCCCAAGAATGGG 0: 1
1: 1
2: 0
3: 3
4: 115
1123062323_1123062335 25 Left 1123062323 14:105599857-105599879 CCCTCCTGGGGGGCCCATTCCTC No data
Right 1123062335 14:105599905-105599927 CCCTGCCCGCTCCCAAGAATGGG 0: 1
1: 1
2: 0
3: 3
4: 115
1123062327_1123062335 11 Left 1123062327 14:105599871-105599893 CCATTCCTCTGTGCCAAGATGCA No data
Right 1123062335 14:105599905-105599927 CCCTGCCCGCTCCCAAGAATGGG 0: 1
1: 1
2: 0
3: 3
4: 115
1123062326_1123062335 12 Left 1123062326 14:105599870-105599892 CCCATTCCTCTGTGCCAAGATGC No data
Right 1123062335 14:105599905-105599927 CCCTGCCCGCTCCCAAGAATGGG 0: 1
1: 1
2: 0
3: 3
4: 115

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1123062335 Original CRISPR CCCTGCCCGCTCCCAAGAAT GGG Intergenic
900203012 1:1419773-1419795 CCCTGCCCGCTGCCCAGGAACGG + Intronic
900400049 1:2469310-2469332 CACTGCCCCCTCCTAAGACTAGG - Intronic
901833991 1:11911903-11911925 CACTGCACCCACCCAAGAATTGG - Intergenic
902148247 1:14421071-14421093 CGCTGCCCTCTCTCAGGAATTGG + Intergenic
907429873 1:54405754-54405776 CTCCGCCGGCTCCCAACAATGGG + Intronic
915264596 1:154707755-154707777 CTCTTCCCGCTCCCAAGTAGAGG + Exonic
915320026 1:155051444-155051466 TCCTGGCCGCTCCCAAATATAGG + Exonic
916185691 1:162130537-162130559 TCTTGCCACCTCCCAAGAATAGG + Intronic
918000050 1:180485252-180485274 CCCTGCCCTATCCCTGGAATTGG - Intronic
924302273 1:242651886-242651908 CCCTGCCACCTCCCCGGAATAGG - Intergenic
1063094610 10:2898697-2898719 CCCTGCCAGCTCCCAAGCCCTGG + Intergenic
1065496107 10:26330010-26330032 CCCTGGCCTCCCCCAACAATAGG - Intergenic
1070752879 10:78974185-78974207 CCCTGCCCCCTCCCCAGAGATGG + Intergenic
1070767677 10:79066127-79066149 GCCTGCCCACTTCCAGGAATTGG - Intergenic
1071390148 10:85165920-85165942 TTCTGCCCACTCCCAAGCATAGG + Intergenic
1072640411 10:97207213-97207235 CCCTGCCAGCTCCCCAGGGTGGG + Intronic
1072640427 10:97207258-97207280 CCCTGCCGGCTCCCCAGGGTGGG + Intronic
1074251165 10:111749455-111749477 TCCTGCCCCCTCCCACAAATAGG - Intergenic
1076159402 10:128231583-128231605 CCCTGCCAGCTCCTTAGAACAGG + Intergenic
1077339951 11:2021801-2021823 CCCTGCCCACTCCCAAGTCAAGG - Intergenic
1077366227 11:2162411-2162433 CCCTCCCAGCTCCCCAGAACAGG + Intergenic
1084974783 11:72790799-72790821 CCCTGCCAGCTTCCCAGAACTGG + Intronic
1086409691 11:86531819-86531841 CCCTCCCCCCACCCAAAAATAGG - Intronic
1088376830 11:109150604-109150626 CCCTGCCCCCTCCTAACAAAAGG + Intergenic
1089200868 11:116724064-116724086 CCCGGCCCCCTCCCCACAATAGG + Intergenic
1202822936 11_KI270721v1_random:76990-77012 CCCTGCCCACTCCCAAGTCAAGG - Intergenic
1096773056 12:53948783-53948805 CCTTTCCTTCTCCCAAGAATTGG + Intergenic
1096961231 12:55579925-55579947 TCCAGCCCTCTCTCAAGAATTGG + Intergenic
1102070519 12:110015385-110015407 CCCTGCCCTTTGCCTAGAATAGG + Intronic
1102491211 12:113290604-113290626 CTCTGCCCACTCCCATGAAGAGG + Intronic
1104475177 12:129065183-129065205 TCATGGCCGTTCCCAAGAATTGG + Intergenic
1108596576 13:51955041-51955063 CGCTGCCAGCACCCAAGACTTGG + Intronic
1112907469 13:104442766-104442788 CCCTACCTACTCCCAAGAACAGG - Intergenic
1116779564 14:49221671-49221693 CCCTCTCCACTCCCAGGAATCGG + Intergenic
1117623655 14:57613432-57613454 CCCTGTCCTCCCCCAACAATGGG + Intronic
1119155008 14:72402068-72402090 TCCTGCCCGATCCCACGGATTGG - Intronic
1123062335 14:105599905-105599927 CCCTGCCCGCTCCCAAGAATGGG + Intergenic
1123087077 14:105721633-105721655 CCCTGCCCGCTCCCAAGAACGGG + Intergenic
1127319158 15:57826050-57826072 CCCTCCCCTCACCCAGGAATCGG + Intergenic
1129260634 15:74365355-74365377 CCCTTCCCTTTCCCAAGAATCGG - Intronic
1132851131 16:2025528-2025550 CCCTGCCCCCACCCAAGCACAGG - Intronic
1139645431 16:68326162-68326184 CCCTGCCTGCCCCCAAAACTTGG - Intronic
1141134668 16:81457678-81457700 CCCTGCCTGCTCCAGAAAATGGG - Intronic
1141555020 16:84831375-84831397 CCCTGCCATCCCCCAAGCATTGG + Intronic
1142147538 16:88498902-88498924 CCCTCCCCTCTCCCAAGCACTGG + Intronic
1142298554 16:89242956-89242978 CCCTGCCTGCTCAAAAGAAAGGG + Intergenic
1143251588 17:5527064-5527086 CCCTGCCCGGCCCCAGGGATTGG + Intronic
1143780772 17:9228191-9228213 CCTTGCCCCCTCTAAAGAATGGG - Intronic
1145988301 17:29062259-29062281 CCCAGCCTGCCCCCAAGCATCGG + Intergenic
1147038203 17:37697685-37697707 CCCTGCCCACTACAAAGAGTGGG + Intronic
1150208323 17:63426354-63426376 CTCTGGCTGCTCCCAAGAAAAGG + Exonic
1151685274 17:75642589-75642611 CTCAGCCCCCTCCAAAGAATAGG + Intronic
1152901230 17:82942226-82942248 CCCTTCCCGCTCCCCAGATGGGG + Intronic
1162514296 19:11138847-11138869 CCCTCCCCGCTCCCCAGTCTGGG + Intronic
1165104629 19:33461719-33461741 CCCTGCCCGCTCCGAGGATCTGG - Intronic
1166358232 19:42240074-42240096 CCCAGAGCGCTCCCAAGAAGTGG - Exonic
1168110879 19:54190755-54190777 CCCTGCCCCCTCCCGAGCACAGG - Intronic
926726287 2:16000812-16000834 GGCTGCCAGCTCCCAAGAAAAGG - Intergenic
927146915 2:20172338-20172360 CCCTGCCCACTCCCAGGTCTGGG + Intergenic
929079790 2:38110856-38110878 CCCTTCCCTCTCTCAAGAACTGG + Intergenic
934853603 2:97716050-97716072 CCCTGCCCCCTCCCCAGCCTGGG - Intronic
937153624 2:119702953-119702975 TCCTGCCCGGTCACAGGAATTGG - Intergenic
939892043 2:147747812-147747834 CCCTGCCCTCTGCTAAAAATTGG + Intergenic
944294298 2:198044771-198044793 CCCTCCCCTCACCCAAAAATAGG - Intronic
947623521 2:231605245-231605267 GCCTGGCAGCTCCCAAGGATCGG - Intergenic
948496919 2:238356594-238356616 CGCTGCCCCCTCCCAAGACGGGG - Intronic
948684294 2:239660323-239660345 CCCCGCCCGCCCCCCAGACTAGG + Intergenic
948790326 2:240373469-240373491 CCCTGCCGGCCCCCGAGACTCGG - Intergenic
1169332132 20:4724467-4724489 CCCTGCCCCCTCCCAAGTGCAGG - Intronic
1172005377 20:31815879-31815901 CCCTGCCCACCCTCAAGAAGGGG - Intergenic
1172042105 20:32052774-32052796 CCCCGCCCCCCCCCAAGAAGGGG - Intronic
1172448878 20:35007941-35007963 CCTTGCCCTTTCACAAGAATGGG + Intronic
1173870884 20:46341484-46341506 CCCTGCCCACTCCCAAGTTCAGG + Intergenic
1178701081 21:34834601-34834623 CCCTCCCTGCTCCCCACAATAGG - Exonic
1179786840 21:43734975-43734997 TCCTTCCCACTCCCAAGAGTAGG - Intronic
1179913706 21:44463079-44463101 CCCTGCCCTTTCCCAAGCAGAGG + Intergenic
1183364293 22:37399091-37399113 CCCTCCCCACTCCCAGGGATGGG + Intronic
1183467106 22:37985314-37985336 CCCTACCCTCTCCCAAGACAGGG - Intronic
1184175677 22:42787504-42787526 TCCTGCCCCCTGCCAAGTATTGG - Intergenic
1184861913 22:47177121-47177143 CCCTGCCCGGTCCCAGGGAGAGG + Intergenic
949810017 3:7997137-7997159 CCCTGCTCCCTCCCATGTATAGG + Intergenic
953349783 3:42206871-42206893 CCTCACCCGCTCCCAAGGATGGG - Intronic
954305937 3:49725414-49725436 CCCTCCCAGCCCCAAAGAATGGG + Exonic
955739274 3:62072901-62072923 CCCTGCCCTATCCCTAGAATTGG - Intronic
962746452 3:138400619-138400641 CACTGCCCTCTCCCTAGAAGCGG + Intronic
965013023 3:163121372-163121394 CTCTGACAGCTCCTAAGAATTGG + Intergenic
967930710 3:194688165-194688187 CCTTGCCCGCCCCCAGGAAGGGG + Exonic
968915968 4:3497219-3497241 CCATGCCCCCTCCCAGGAACAGG - Intronic
980291175 4:130848538-130848560 CCCTGCCAACTCCAAAGAGTAGG + Intergenic
985825482 5:2187836-2187858 CCCTCCCCGCACCCCAGAAAAGG + Intergenic
986773075 5:10990842-10990864 CCCTGCCTGCTCGCGAGAAAAGG + Intronic
987642804 5:20633748-20633770 CCCTGCCCCCTCCCAGCAGTAGG + Intergenic
988542328 5:32121861-32121883 ATCTGCCAGCTCCCAAGACTGGG + Intergenic
991584406 5:68187601-68187623 CCCCGCCCGCTCCCAAGCCCGGG - Intergenic
994286851 5:97979693-97979715 CCCTGCCCCCTCCAAGAAATGGG - Intergenic
996064622 5:119067400-119067422 CACTGCCCCCGGCCAAGAATAGG + Intronic
999732169 5:154482951-154482973 CCCAGCCTGCTCCCAGGGATGGG + Intergenic
999858404 5:155619826-155619848 CCCTGCCCGCTCCCTGGAGCCGG + Intergenic
1006320584 6:33317351-33317373 CCCTGCCCCCTCCCAAAAAGTGG - Intronic
1007147024 6:39645963-39645985 CCCTGCCCCCACCCAACAACAGG - Intronic
1011925557 6:92640456-92640478 CCCTCCCCACTCCCAATAAATGG + Intergenic
1013603890 6:111730561-111730583 CCCTTCCCTCTCCCACCAATTGG - Intronic
1023790558 7:43750063-43750085 TCCTGCCTGCTCCCTAGAGTGGG + Intergenic
1028355008 7:89896629-89896651 CCCTGCCCCCACCCCACAATAGG + Intergenic
1029449543 7:100633197-100633219 CCCTGCCCGCTCCTAGGATGGGG - Intronic
1029693629 7:102199048-102199070 GCCTGCCCTCTCCCAAGCACAGG + Intronic
1034680361 7:152923811-152923833 GCCTGCCCGCTCCTGGGAATGGG - Intergenic
1039844451 8:41315941-41315963 CCTTCCCTGCTCCCAAGAACTGG + Intergenic
1045542344 8:103098938-103098960 ACCTGCCTGCGCCCAAGACTTGG - Intergenic
1046300347 8:112278108-112278130 AACTGCCCCCTCCCCAGAATTGG - Intronic
1056487409 9:87072948-87072970 CCCTGCCCGCACCCAGCAACTGG + Intergenic
1061420909 9:130472423-130472445 CCCGGCCCGCTCCCCAGACATGG - Intronic
1061621177 9:131812297-131812319 CCCTGCCCTGTCCAAGGAATAGG - Intergenic
1062004704 9:134233384-134233406 CCCTCCCCGCTTCCAGGAACCGG - Intergenic
1062524182 9:136971663-136971685 CCCTGCCCTGTGCCAAGAAGGGG - Exonic
1189207432 X:39254028-39254050 CCCTGTCCTTTCCCAGGAATGGG - Intergenic
1191127663 X:56974865-56974887 CCCTGCCCGCTGCCTAGACAAGG - Intergenic
1198220037 X:134590579-134590601 CCTTGCCAGATCCCGAGAATAGG - Intronic
1198534028 X:137569202-137569224 CCCCGCCCGGTCCCCAAAATGGG - Intronic
1202088773 Y:21166274-21166296 CCATCCAAGCTCCCAAGAATTGG - Intergenic