ID: 1123062626

View in Genome Browser
Species Human (GRCh38)
Location 14:105601148-105601170
Sequence CAGTCGTCCTGCGACGGCGG CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 11 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1123062626_1123062639 25 Left 1123062626 14:105601148-105601170 CCGCCGCCGTCGCAGGACGACTG No data
Right 1123062639 14:105601196-105601218 AAGTCCCTGGAGCAGACTGGGGG No data
1123062626_1123062638 24 Left 1123062626 14:105601148-105601170 CCGCCGCCGTCGCAGGACGACTG No data
Right 1123062638 14:105601195-105601217 GAAGTCCCTGGAGCAGACTGGGG No data
1123062626_1123062633 -1 Left 1123062626 14:105601148-105601170 CCGCCGCCGTCGCAGGACGACTG No data
Right 1123062633 14:105601170-105601192 GTAAGATCTTCACGGTGGGCGGG No data
1123062626_1123062630 -6 Left 1123062626 14:105601148-105601170 CCGCCGCCGTCGCAGGACGACTG No data
Right 1123062630 14:105601165-105601187 CGACTGTAAGATCTTCACGGTGG No data
1123062626_1123062637 23 Left 1123062626 14:105601148-105601170 CCGCCGCCGTCGCAGGACGACTG No data
Right 1123062637 14:105601194-105601216 TGAAGTCCCTGGAGCAGACTGGG No data
1123062626_1123062629 -9 Left 1123062626 14:105601148-105601170 CCGCCGCCGTCGCAGGACGACTG No data
Right 1123062629 14:105601162-105601184 GGACGACTGTAAGATCTTCACGG No data
1123062626_1123062634 0 Left 1123062626 14:105601148-105601170 CCGCCGCCGTCGCAGGACGACTG No data
Right 1123062634 14:105601171-105601193 TAAGATCTTCACGGTGGGCGGGG No data
1123062626_1123062631 -5 Left 1123062626 14:105601148-105601170 CCGCCGCCGTCGCAGGACGACTG No data
Right 1123062631 14:105601166-105601188 GACTGTAAGATCTTCACGGTGGG 0: 2
1: 0
2: 0
3: 6
4: 67
1123062626_1123062636 22 Left 1123062626 14:105601148-105601170 CCGCCGCCGTCGCAGGACGACTG No data
Right 1123062636 14:105601193-105601215 GTGAAGTCCCTGGAGCAGACTGG No data
1123062626_1123062632 -2 Left 1123062626 14:105601148-105601170 CCGCCGCCGTCGCAGGACGACTG No data
Right 1123062632 14:105601169-105601191 TGTAAGATCTTCACGGTGGGCGG No data
1123062626_1123062635 12 Left 1123062626 14:105601148-105601170 CCGCCGCCGTCGCAGGACGACTG No data
Right 1123062635 14:105601183-105601205 GGTGGGCGGGGTGAAGTCCCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1123062626 Original CRISPR CAGTCGTCCTGCGACGGCGG CGG (reversed) Intergenic
No off target data available for this crispr