ID: 1123065809

View in Genome Browser
Species Human (GRCh38)
Location 14:105618601-105618623
Sequence CAGCGTGTCCTGAGAGTTAA AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 14 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1123065794_1123065809 23 Left 1123065794 14:105618555-105618577 CCCTGCACCCCAGGTGCTGTCTC No data
Right 1123065809 14:105618601-105618623 CAGCGTGTCCTGAGAGTTAAAGG No data
1123065798_1123065809 14 Left 1123065798 14:105618564-105618586 CCAGGTGCTGTCTCCCTCACCCC No data
Right 1123065809 14:105618601-105618623 CAGCGTGTCCTGAGAGTTAAAGG No data
1123065797_1123065809 15 Left 1123065797 14:105618563-105618585 CCCAGGTGCTGTCTCCCTCACCC No data
Right 1123065809 14:105618601-105618623 CAGCGTGTCCTGAGAGTTAAAGG No data
1123065804_1123065809 -5 Left 1123065804 14:105618583-105618605 CCCCCCGCGGGGCTGCAGCAGCG No data
Right 1123065809 14:105618601-105618623 CAGCGTGTCCTGAGAGTTAAAGG No data
1123065795_1123065809 22 Left 1123065795 14:105618556-105618578 CCTGCACCCCAGGTGCTGTCTCC No data
Right 1123065809 14:105618601-105618623 CAGCGTGTCCTGAGAGTTAAAGG No data
1123065803_1123065809 0 Left 1123065803 14:105618578-105618600 CCTCACCCCCCGCGGGGCTGCAG No data
Right 1123065809 14:105618601-105618623 CAGCGTGTCCTGAGAGTTAAAGG No data
1123065792_1123065809 27 Left 1123065792 14:105618551-105618573 CCCGCCCTGCACCCCAGGTGCTG No data
Right 1123065809 14:105618601-105618623 CAGCGTGTCCTGAGAGTTAAAGG No data
1123065805_1123065809 -6 Left 1123065805 14:105618584-105618606 CCCCCGCGGGGCTGCAGCAGCGT No data
Right 1123065809 14:105618601-105618623 CAGCGTGTCCTGAGAGTTAAAGG No data
1123065793_1123065809 26 Left 1123065793 14:105618552-105618574 CCGCCCTGCACCCCAGGTGCTGT No data
Right 1123065809 14:105618601-105618623 CAGCGTGTCCTGAGAGTTAAAGG No data
1123065807_1123065809 -8 Left 1123065807 14:105618586-105618608 CCCGCGGGGCTGCAGCAGCGTGT No data
Right 1123065809 14:105618601-105618623 CAGCGTGTCCTGAGAGTTAAAGG No data
1123065796_1123065809 16 Left 1123065796 14:105618562-105618584 CCCCAGGTGCTGTCTCCCTCACC No data
Right 1123065809 14:105618601-105618623 CAGCGTGTCCTGAGAGTTAAAGG No data
1123065802_1123065809 1 Left 1123065802 14:105618577-105618599 CCCTCACCCCCCGCGGGGCTGCA No data
Right 1123065809 14:105618601-105618623 CAGCGTGTCCTGAGAGTTAAAGG No data
1123065808_1123065809 -9 Left 1123065808 14:105618587-105618609 CCGCGGGGCTGCAGCAGCGTGTC No data
Right 1123065809 14:105618601-105618623 CAGCGTGTCCTGAGAGTTAAAGG No data
1123065806_1123065809 -7 Left 1123065806 14:105618585-105618607 CCCCGCGGGGCTGCAGCAGCGTG No data
Right 1123065809 14:105618601-105618623 CAGCGTGTCCTGAGAGTTAAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1123065809 Original CRISPR CAGCGTGTCCTGAGAGTTAA AGG Intergenic
No off target data available for this crispr