ID: 1123077868

View in Genome Browser
Species Human (GRCh38)
Location 14:105678332-105678354
Sequence CCGCGGGGCTGCGCTCGGGC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1123077853_1123077868 20 Left 1123077853 14:105678289-105678311 CCTTTGGGCAGAAGAAGCCCTTG No data
Right 1123077868 14:105678332-105678354 CCGCGGGGCTGCGCTCGGGCTGG No data
1123077861_1123077868 -9 Left 1123077861 14:105678318-105678340 CCTCCGTCCAGCCTCCGCGGGGC No data
Right 1123077868 14:105678332-105678354 CCGCGGGGCTGCGCTCGGGCTGG No data
1123077856_1123077868 3 Left 1123077856 14:105678306-105678328 CCCTTGTGGGAGCCTCCGTCCAG No data
Right 1123077868 14:105678332-105678354 CCGCGGGGCTGCGCTCGGGCTGG No data
1123077857_1123077868 2 Left 1123077857 14:105678307-105678329 CCTTGTGGGAGCCTCCGTCCAGC No data
Right 1123077868 14:105678332-105678354 CCGCGGGGCTGCGCTCGGGCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1123077868 Original CRISPR CCGCGGGGCTGCGCTCGGGC TGG Intergenic
No off target data available for this crispr