ID: 1123079091

View in Genome Browser
Species Human (GRCh38)
Location 14:105683038-105683060
Sequence CTGTCAGAGGGGTCCCTCAG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1123079091_1123079097 -1 Left 1123079091 14:105683038-105683060 CCTCTGAGGGACCCCTCTGACAG No data
Right 1123079097 14:105683060-105683082 GACTGCAGGCAAGCTGTCAAGGG No data
1123079091_1123079096 -2 Left 1123079091 14:105683038-105683060 CCTCTGAGGGACCCCTCTGACAG No data
Right 1123079096 14:105683059-105683081 AGACTGCAGGCAAGCTGTCAAGG No data
1123079091_1123079099 15 Left 1123079091 14:105683038-105683060 CCTCTGAGGGACCCCTCTGACAG No data
Right 1123079099 14:105683076-105683098 TCAAGGGTGTGTATGTGTGAGGG No data
1123079091_1123079098 14 Left 1123079091 14:105683038-105683060 CCTCTGAGGGACCCCTCTGACAG No data
Right 1123079098 14:105683075-105683097 GTCAAGGGTGTGTATGTGTGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1123079091 Original CRISPR CTGTCAGAGGGGTCCCTCAG AGG (reversed) Intergenic
No off target data available for this crispr