ID: 1123079418

View in Genome Browser
Species Human (GRCh38)
Location 14:105684627-105684649
Sequence GCCCTTGTGGACCTGAGTGT GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1123079415_1123079418 -6 Left 1123079415 14:105684610-105684632 CCTCTGTGACGCTGTGAGCCCTT No data
Right 1123079418 14:105684627-105684649 GCCCTTGTGGACCTGAGTGTGGG No data
1123079410_1123079418 24 Left 1123079410 14:105684580-105684602 CCTGTGCTTGTCTGGCTGTGGGA No data
Right 1123079418 14:105684627-105684649 GCCCTTGTGGACCTGAGTGTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1123079418 Original CRISPR GCCCTTGTGGACCTGAGTGT GGG Intergenic
No off target data available for this crispr