ID: 1123081067

View in Genome Browser
Species Human (GRCh38)
Location 14:105695868-105695890
Sequence CTGGAGGCTCAGATGGAGAC GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1123081061_1123081067 7 Left 1123081061 14:105695838-105695860 CCAGAGACAGGGACAGCGGGAAA No data
Right 1123081067 14:105695868-105695890 CTGGAGGCTCAGATGGAGACGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1123081067 Original CRISPR CTGGAGGCTCAGATGGAGAC GGG Intergenic
No off target data available for this crispr