ID: 1123081093

View in Genome Browser
Species Human (GRCh38)
Location 14:105695975-105695997
Sequence CTGAGGTTACATGGTGATGG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1123081093_1123081107 25 Left 1123081093 14:105695975-105695997 CCCCCATCACCATGTAACCTCAG No data
Right 1123081107 14:105696023-105696045 TCAGTGTTCTCTCTGTACAGTGG No data
1123081093_1123081108 26 Left 1123081093 14:105695975-105695997 CCCCCATCACCATGTAACCTCAG No data
Right 1123081108 14:105696024-105696046 CAGTGTTCTCTCTGTACAGTGGG No data
1123081093_1123081109 27 Left 1123081093 14:105695975-105695997 CCCCCATCACCATGTAACCTCAG No data
Right 1123081109 14:105696025-105696047 AGTGTTCTCTCTGTACAGTGGGG No data
1123081093_1123081099 -10 Left 1123081093 14:105695975-105695997 CCCCCATCACCATGTAACCTCAG No data
Right 1123081099 14:105695988-105696010 GTAACCTCAGGCCATGTCCCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1123081093 Original CRISPR CTGAGGTTACATGGTGATGG GGG (reversed) Intergenic
No off target data available for this crispr