ID: 1123082521

View in Genome Browser
Species Human (GRCh38)
Location 14:105702431-105702453
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1123082521_1123082525 6 Left 1123082521 14:105702431-105702453 CCAGTGATCAGGGCCAGGGCTCA No data
Right 1123082525 14:105702460-105702482 CAGAACATGGCCCAGTGATCAGG No data
1123082521_1123082523 -7 Left 1123082521 14:105702431-105702453 CCAGTGATCAGGGCCAGGGCTCA No data
Right 1123082523 14:105702447-105702469 GGGCTCATTGATCCAGAACATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1123082521 Original CRISPR TGAGCCCTGGCCCTGATCAC TGG (reversed) Intergenic
No off target data available for this crispr