ID: 1123082522

View in Genome Browser
Species Human (GRCh38)
Location 14:105702444-105702466
Sequence TGTTCTGGATCAATGAGCCC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1123082522_1123082525 -7 Left 1123082522 14:105702444-105702466 CCAGGGCTCATTGATCCAGAACA No data
Right 1123082525 14:105702460-105702482 CAGAACATGGCCCAGTGATCAGG No data
1123082522_1123082529 30 Left 1123082522 14:105702444-105702466 CCAGGGCTCATTGATCCAGAACA No data
Right 1123082529 14:105702497-105702519 ATCCAGACCAGGACTGAGTTAGG No data
1123082522_1123082528 19 Left 1123082522 14:105702444-105702466 CCAGGGCTCATTGATCCAGAACA No data
Right 1123082528 14:105702486-105702508 AAGACTCAGCGATCCAGACCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1123082522 Original CRISPR TGTTCTGGATCAATGAGCCC TGG (reversed) Intergenic
No off target data available for this crispr