ID: 1123082523

View in Genome Browser
Species Human (GRCh38)
Location 14:105702447-105702469
Sequence GGGCTCATTGATCCAGAACA TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1123082520_1123082523 -6 Left 1123082520 14:105702430-105702452 CCCAGTGATCAGGGCCAGGGCTC No data
Right 1123082523 14:105702447-105702469 GGGCTCATTGATCCAGAACATGG No data
1123082517_1123082523 0 Left 1123082517 14:105702424-105702446 CCAGGGCCCAGTGATCAGGGCCA No data
Right 1123082523 14:105702447-105702469 GGGCTCATTGATCCAGAACATGG No data
1123082521_1123082523 -7 Left 1123082521 14:105702431-105702453 CCAGTGATCAGGGCCAGGGCTCA No data
Right 1123082523 14:105702447-105702469 GGGCTCATTGATCCAGAACATGG No data
1123082512_1123082523 20 Left 1123082512 14:105702404-105702426 CCAGAGCATAGTTAGCAGGACCA No data
Right 1123082523 14:105702447-105702469 GGGCTCATTGATCCAGAACATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1123082523 Original CRISPR GGGCTCATTGATCCAGAACA TGG Intergenic
No off target data available for this crispr