ID: 1123082525

View in Genome Browser
Species Human (GRCh38)
Location 14:105702460-105702482
Sequence CAGAACATGGCCCAGTGATC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1123082520_1123082525 7 Left 1123082520 14:105702430-105702452 CCCAGTGATCAGGGCCAGGGCTC No data
Right 1123082525 14:105702460-105702482 CAGAACATGGCCCAGTGATCAGG No data
1123082517_1123082525 13 Left 1123082517 14:105702424-105702446 CCAGGGCCCAGTGATCAGGGCCA No data
Right 1123082525 14:105702460-105702482 CAGAACATGGCCCAGTGATCAGG No data
1123082522_1123082525 -7 Left 1123082522 14:105702444-105702466 CCAGGGCTCATTGATCCAGAACA No data
Right 1123082525 14:105702460-105702482 CAGAACATGGCCCAGTGATCAGG No data
1123082521_1123082525 6 Left 1123082521 14:105702431-105702453 CCAGTGATCAGGGCCAGGGCTCA No data
Right 1123082525 14:105702460-105702482 CAGAACATGGCCCAGTGATCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1123082525 Original CRISPR CAGAACATGGCCCAGTGATC AGG Intergenic
No off target data available for this crispr