ID: 1123084129 |
View in Genome Browser |
| Species | Human (GRCh38) |
| Location | 14:105709633-105709655 |
| Sequence | TGTACTAAGCTGGCCTGGGC TGG (reversed) |
| Strand | - |
| Crispr in exon? | No |
| Crispr in intron? | No |
| Off-Target Counts | All | Exonic | Intronic | Intergenic |
|---|---|---|---|---|
| Total | ||||
| Summary |
Found 2 Related Crispr Pairs
Show Crispr Pairs| ID | Spacer | Status | Summary | ID | Location | Sequence | Summary | |
|---|---|---|---|---|---|---|---|---|
| 1123084129_1123084133 | 3 | Left | 1123084129 | 14:105709633-105709655 | CCAGCCCAGGCCAGCTTAGTACA | No data | ||
| Right | 1123084133 | 14:105709659-105709681 | CAGCCCAGCCCAGCTCAGCCTGG | No data | ||||
| 1123084129_1123084136 | 9 | Left | 1123084129 | 14:105709633-105709655 | CCAGCCCAGGCCAGCTTAGTACA | No data | ||
| Right | 1123084136 | 14:105709665-105709687 | AGCCCAGCTCAGCCTGGCCCAGG | No data |
Note: the row highlighted in blue is the original CRISPR
| WGE ID | Location | Sequence | Mismatches | Strand | Type |
|---|---|---|---|---|---|
| 1123084129 | Original CRISPR | TGTACTAAGCTGGCCTGGGC TGG (reversed) | Intergenic | ||