ID: 1123084130

View in Genome Browser
Species Human (GRCh38)
Location 14:105709637-105709659
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1123084130_1123084136 5 Left 1123084130 14:105709637-105709659 CCCAGGCCAGCTTAGTACAGCTC No data
Right 1123084136 14:105709665-105709687 AGCCCAGCTCAGCCTGGCCCAGG No data
1123084130_1123084133 -1 Left 1123084130 14:105709637-105709659 CCCAGGCCAGCTTAGTACAGCTC No data
Right 1123084133 14:105709659-105709681 CAGCCCAGCCCAGCTCAGCCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1123084130 Original CRISPR GAGCTGTACTAAGCTGGCCT GGG (reversed) Intergenic