ID: 1123084131

View in Genome Browser
Species Human (GRCh38)
Location 14:105709638-105709660
Sequence TGAGCTGTACTAAGCTGGCC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1123084131_1123084133 -2 Left 1123084131 14:105709638-105709660 CCAGGCCAGCTTAGTACAGCTCA No data
Right 1123084133 14:105709659-105709681 CAGCCCAGCCCAGCTCAGCCTGG No data
1123084131_1123084136 4 Left 1123084131 14:105709638-105709660 CCAGGCCAGCTTAGTACAGCTCA No data
Right 1123084136 14:105709665-105709687 AGCCCAGCTCAGCCTGGCCCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1123084131 Original CRISPR TGAGCTGTACTAAGCTGGCC TGG (reversed) Intergenic