ID: 1123084133

View in Genome Browser
Species Human (GRCh38)
Location 14:105709659-105709681
Sequence CAGCCCAGCCCAGCTCAGCC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1123084130_1123084133 -1 Left 1123084130 14:105709637-105709659 CCCAGGCCAGCTTAGTACAGCTC No data
Right 1123084133 14:105709659-105709681 CAGCCCAGCCCAGCTCAGCCTGG No data
1123084126_1123084133 23 Left 1123084126 14:105709613-105709635 CCAGCTCAGTACAGCTCAGCCCA No data
Right 1123084133 14:105709659-105709681 CAGCCCAGCCCAGCTCAGCCTGG No data
1123084128_1123084133 4 Left 1123084128 14:105709632-105709654 CCCAGCCCAGGCCAGCTTAGTAC No data
Right 1123084133 14:105709659-105709681 CAGCCCAGCCCAGCTCAGCCTGG No data
1123084131_1123084133 -2 Left 1123084131 14:105709638-105709660 CCAGGCCAGCTTAGTACAGCTCA No data
Right 1123084133 14:105709659-105709681 CAGCCCAGCCCAGCTCAGCCTGG No data
1123084129_1123084133 3 Left 1123084129 14:105709633-105709655 CCAGCCCAGGCCAGCTTAGTACA No data
Right 1123084133 14:105709659-105709681 CAGCCCAGCCCAGCTCAGCCTGG No data
1123084125_1123084133 28 Left 1123084125 14:105709608-105709630 CCAGGCCAGCTCAGTACAGCTCA No data
Right 1123084133 14:105709659-105709681 CAGCCCAGCCCAGCTCAGCCTGG No data
1123084132_1123084133 -7 Left 1123084132 14:105709643-105709665 CCAGCTTAGTACAGCTCAGCCCA No data
Right 1123084133 14:105709659-105709681 CAGCCCAGCCCAGCTCAGCCTGG No data
1123084124_1123084133 29 Left 1123084124 14:105709607-105709629 CCCAGGCCAGCTCAGTACAGCTC No data
Right 1123084133 14:105709659-105709681 CAGCCCAGCCCAGCTCAGCCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1123084133 Original CRISPR CAGCCCAGCCCAGCTCAGCC TGG Intergenic