ID: 1123086483

View in Genome Browser
Species Human (GRCh38)
Location 14:105719404-105719426
Sequence GCGTGAGTGGCCCGCGGCCT AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1123086473_1123086483 25 Left 1123086473 14:105719356-105719378 CCCGAGGGAGGCTCAGGCGCTGG No data
Right 1123086483 14:105719404-105719426 GCGTGAGTGGCCCGCGGCCTAGG No data
1123086475_1123086483 24 Left 1123086475 14:105719357-105719379 CCGAGGGAGGCTCAGGCGCTGGC No data
Right 1123086483 14:105719404-105719426 GCGTGAGTGGCCCGCGGCCTAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1123086483 Original CRISPR GCGTGAGTGGCCCGCGGCCT AGG Intergenic