ID: 1123086483 |
View in Genome Browser |
Species | Human (GRCh38) |
Location | 14:105719404-105719426 |
Sequence | GCGTGAGTGGCCCGCGGCCT AGG |
Strand | + |
Crispr in exon? | No |
Crispr in intron? | No |
Off-Target Counts | All | Exonic | Intronic | Intergenic |
---|---|---|---|---|
Total | ||||
Summary |
Found 2 Related Crispr Pairs
Show Crispr PairsID | Spacer | Status | Summary | ID | Location | Sequence | Summary | |
---|---|---|---|---|---|---|---|---|
1123086473_1123086483 | 25 | Left | 1123086473 | 14:105719356-105719378 | CCCGAGGGAGGCTCAGGCGCTGG | No data | ||
Right | 1123086483 | 14:105719404-105719426 | GCGTGAGTGGCCCGCGGCCTAGG | No data | ||||
1123086475_1123086483 | 24 | Left | 1123086475 | 14:105719357-105719379 | CCGAGGGAGGCTCAGGCGCTGGC | No data | ||
Right | 1123086483 | 14:105719404-105719426 | GCGTGAGTGGCCCGCGGCCTAGG | No data |
Note: the row highlighted in blue is the original CRISPR
WGE ID | Location | Sequence | Mismatches | Strand | Type |
---|---|---|---|---|---|
1123086483 | Original CRISPR | GCGTGAGTGGCCCGCGGCCT AGG | Intergenic | ||