ID: 1123086610

View in Genome Browser
Species Human (GRCh38)
Location 14:105719866-105719888
Sequence GACCTGGGTGCCCACCCTCA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1123086610_1123086617 5 Left 1123086610 14:105719866-105719888 CCCTGAGGGTGGGCACCCAGGTC No data
Right 1123086617 14:105719894-105719916 TCAGTCAACGGCCCAGAGCCAGG No data
1123086610_1123086614 -7 Left 1123086610 14:105719866-105719888 CCCTGAGGGTGGGCACCCAGGTC No data
Right 1123086614 14:105719882-105719904 CCAGGTCCCGAGTCAGTCAACGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1123086610 Original CRISPR GACCTGGGTGCCCACCCTCA GGG (reversed) Intergenic
No off target data available for this crispr