ID: 1123092233

View in Genome Browser
Species Human (GRCh38)
Location 14:105746985-105747007
Sequence CTGGAACCTCAGCTCCTCAG TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1123092223_1123092233 22 Left 1123092223 14:105746940-105746962 CCCGGATCCTCCTGTCCCTGCAC No data
Right 1123092233 14:105746985-105747007 CTGGAACCTCAGCTCCTCAGTGG No data
1123092229_1123092233 6 Left 1123092229 14:105746956-105746978 CCTGCACTGCTCCTGCTCTGGAA No data
Right 1123092233 14:105746985-105747007 CTGGAACCTCAGCTCCTCAGTGG No data
1123092228_1123092233 7 Left 1123092228 14:105746955-105746977 CCCTGCACTGCTCCTGCTCTGGA No data
Right 1123092233 14:105746985-105747007 CTGGAACCTCAGCTCCTCAGTGG No data
1123092226_1123092233 12 Left 1123092226 14:105746950-105746972 CCTGTCCCTGCACTGCTCCTGCT No data
Right 1123092233 14:105746985-105747007 CTGGAACCTCAGCTCCTCAGTGG No data
1123092231_1123092233 -5 Left 1123092231 14:105746967-105746989 CCTGCTCTGGAAGCCTCTCTGGA No data
Right 1123092233 14:105746985-105747007 CTGGAACCTCAGCTCCTCAGTGG No data
1123092224_1123092233 21 Left 1123092224 14:105746941-105746963 CCGGATCCTCCTGTCCCTGCACT No data
Right 1123092233 14:105746985-105747007 CTGGAACCTCAGCTCCTCAGTGG No data
1123092225_1123092233 15 Left 1123092225 14:105746947-105746969 CCTCCTGTCCCTGCACTGCTCCT No data
Right 1123092233 14:105746985-105747007 CTGGAACCTCAGCTCCTCAGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1123092233 Original CRISPR CTGGAACCTCAGCTCCTCAG TGG Intergenic