ID: 1123106609

View in Genome Browser
Species Human (GRCh38)
Location 14:105844771-105844793
Sequence CTGAGGAATGAGCAGGTGGG TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1123106605_1123106609 -9 Left 1123106605 14:105844757-105844779 CCTGGAGGAGGCGGCTGAGGAAT No data
Right 1123106609 14:105844771-105844793 CTGAGGAATGAGCAGGTGGGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1123106609 Original CRISPR CTGAGGAATGAGCAGGTGGG TGG Intergenic
No off target data available for this crispr