ID: 1123108821

View in Genome Browser
Species Human (GRCh38)
Location 14:105855751-105855773
Sequence GTTGCCGAAGAAGCCGTCGC GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1123108815_1123108821 5 Left 1123108815 14:105855723-105855745 CCTGGCAGATGAGCTTGGACTTG No data
Right 1123108821 14:105855751-105855773 GTTGCCGAAGAAGCCGTCGCGGG No data
1123108813_1123108821 11 Left 1123108813 14:105855717-105855739 CCGTGGCCTGGCAGATGAGCTTG No data
Right 1123108821 14:105855751-105855773 GTTGCCGAAGAAGCCGTCGCGGG No data
1123108812_1123108821 12 Left 1123108812 14:105855716-105855738 CCCGTGGCCTGGCAGATGAGCTT No data
Right 1123108821 14:105855751-105855773 GTTGCCGAAGAAGCCGTCGCGGG No data
1123108810_1123108821 25 Left 1123108810 14:105855703-105855725 CCGGGGACTGAAACCCGTGGCCT No data
Right 1123108821 14:105855751-105855773 GTTGCCGAAGAAGCCGTCGCGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1123108821 Original CRISPR GTTGCCGAAGAAGCCGTCGC GGG Intergenic
No off target data available for this crispr