ID: 1123110458

View in Genome Browser
Species Human (GRCh38)
Location 14:105864733-105864755
Sequence GTGGCTGGGGACAGGGACGC CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 9 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1123110458_1123110470 6 Left 1123110458 14:105864733-105864755 CCGGCGTCCCTGTCCCCAGCCAC No data
Right 1123110470 14:105864762-105864784 CCCCGGGCTGAGACCCAGGCAGG No data
1123110458_1123110476 12 Left 1123110458 14:105864733-105864755 CCGGCGTCCCTGTCCCCAGCCAC No data
Right 1123110476 14:105864768-105864790 GCTGAGACCCAGGCAGGGAGGGG No data
1123110458_1123110475 11 Left 1123110458 14:105864733-105864755 CCGGCGTCCCTGTCCCCAGCCAC No data
Right 1123110475 14:105864767-105864789 GGCTGAGACCCAGGCAGGGAGGG No data
1123110458_1123110463 -10 Left 1123110458 14:105864733-105864755 CCGGCGTCCCTGTCCCCAGCCAC No data
Right 1123110463 14:105864746-105864768 CCCCAGCCACACAGACCCCCGGG No data
1123110458_1123110474 10 Left 1123110458 14:105864733-105864755 CCGGCGTCCCTGTCCCCAGCCAC No data
Right 1123110474 14:105864766-105864788 GGGCTGAGACCCAGGCAGGGAGG No data
1123110458_1123110480 26 Left 1123110458 14:105864733-105864755 CCGGCGTCCCTGTCCCCAGCCAC No data
Right 1123110480 14:105864782-105864804 AGGGAGGGGTGACGTTCCCAGGG No data
1123110458_1123110479 25 Left 1123110458 14:105864733-105864755 CCGGCGTCCCTGTCCCCAGCCAC No data
Right 1123110479 14:105864781-105864803 CAGGGAGGGGTGACGTTCCCAGG No data
1123110458_1123110472 7 Left 1123110458 14:105864733-105864755 CCGGCGTCCCTGTCCCCAGCCAC No data
Right 1123110472 14:105864763-105864785 CCCGGGCTGAGACCCAGGCAGGG No data
1123110458_1123110467 2 Left 1123110458 14:105864733-105864755 CCGGCGTCCCTGTCCCCAGCCAC No data
Right 1123110467 14:105864758-105864780 AGACCCCCGGGCTGAGACCCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1123110458 Original CRISPR GTGGCTGGGGACAGGGACGC CGG (reversed) Intergenic