ID: 1123110460

View in Genome Browser
Species Human (GRCh38)
Location 14:105864741-105864763
Sequence GGGTCTGTGTGGCTGGGGAC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 10 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1123110460_1123110467 -6 Left 1123110460 14:105864741-105864763 CCTGTCCCCAGCCACACAGACCC No data
Right 1123110467 14:105864758-105864780 AGACCCCCGGGCTGAGACCCAGG No data
1123110460_1123110479 17 Left 1123110460 14:105864741-105864763 CCTGTCCCCAGCCACACAGACCC No data
Right 1123110479 14:105864781-105864803 CAGGGAGGGGTGACGTTCCCAGG No data
1123110460_1123110482 27 Left 1123110460 14:105864741-105864763 CCTGTCCCCAGCCACACAGACCC No data
Right 1123110482 14:105864791-105864813 TGACGTTCCCAGGGAGACGGTGG No data
1123110460_1123110480 18 Left 1123110460 14:105864741-105864763 CCTGTCCCCAGCCACACAGACCC No data
Right 1123110480 14:105864782-105864804 AGGGAGGGGTGACGTTCCCAGGG No data
1123110460_1123110475 3 Left 1123110460 14:105864741-105864763 CCTGTCCCCAGCCACACAGACCC No data
Right 1123110475 14:105864767-105864789 GGCTGAGACCCAGGCAGGGAGGG No data
1123110460_1123110472 -1 Left 1123110460 14:105864741-105864763 CCTGTCCCCAGCCACACAGACCC No data
Right 1123110472 14:105864763-105864785 CCCGGGCTGAGACCCAGGCAGGG No data
1123110460_1123110470 -2 Left 1123110460 14:105864741-105864763 CCTGTCCCCAGCCACACAGACCC No data
Right 1123110470 14:105864762-105864784 CCCCGGGCTGAGACCCAGGCAGG No data
1123110460_1123110474 2 Left 1123110460 14:105864741-105864763 CCTGTCCCCAGCCACACAGACCC No data
Right 1123110474 14:105864766-105864788 GGGCTGAGACCCAGGCAGGGAGG No data
1123110460_1123110476 4 Left 1123110460 14:105864741-105864763 CCTGTCCCCAGCCACACAGACCC No data
Right 1123110476 14:105864768-105864790 GCTGAGACCCAGGCAGGGAGGGG No data
1123110460_1123110481 24 Left 1123110460 14:105864741-105864763 CCTGTCCCCAGCCACACAGACCC No data
Right 1123110481 14:105864788-105864810 GGGTGACGTTCCCAGGGAGACGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1123110460 Original CRISPR GGGTCTGTGTGGCTGGGGAC AGG (reversed) Intergenic