ID: 1123110462

View in Genome Browser
Species Human (GRCh38)
Location 14:105864746-105864768
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic

Found 11 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1123110462_1123110475 -2 Left 1123110462 14:105864746-105864768 CCCCAGCCACACAGACCCCCGGG No data
Right 1123110475 14:105864767-105864789 GGCTGAGACCCAGGCAGGGAGGG No data
1123110462_1123110482 22 Left 1123110462 14:105864746-105864768 CCCCAGCCACACAGACCCCCGGG No data
Right 1123110482 14:105864791-105864813 TGACGTTCCCAGGGAGACGGTGG No data
1123110462_1123110483 26 Left 1123110462 14:105864746-105864768 CCCCAGCCACACAGACCCCCGGG No data
Right 1123110483 14:105864795-105864817 GTTCCCAGGGAGACGGTGGCCGG No data
1123110462_1123110476 -1 Left 1123110462 14:105864746-105864768 CCCCAGCCACACAGACCCCCGGG No data
Right 1123110476 14:105864768-105864790 GCTGAGACCCAGGCAGGGAGGGG No data
1123110462_1123110479 12 Left 1123110462 14:105864746-105864768 CCCCAGCCACACAGACCCCCGGG No data
Right 1123110479 14:105864781-105864803 CAGGGAGGGGTGACGTTCCCAGG No data
1123110462_1123110481 19 Left 1123110462 14:105864746-105864768 CCCCAGCCACACAGACCCCCGGG No data
Right 1123110481 14:105864788-105864810 GGGTGACGTTCCCAGGGAGACGG No data
1123110462_1123110470 -7 Left 1123110462 14:105864746-105864768 CCCCAGCCACACAGACCCCCGGG No data
Right 1123110470 14:105864762-105864784 CCCCGGGCTGAGACCCAGGCAGG No data
1123110462_1123110474 -3 Left 1123110462 14:105864746-105864768 CCCCAGCCACACAGACCCCCGGG No data
Right 1123110474 14:105864766-105864788 GGGCTGAGACCCAGGCAGGGAGG No data
1123110462_1123110472 -6 Left 1123110462 14:105864746-105864768 CCCCAGCCACACAGACCCCCGGG No data
Right 1123110472 14:105864763-105864785 CCCGGGCTGAGACCCAGGCAGGG No data
1123110462_1123110480 13 Left 1123110462 14:105864746-105864768 CCCCAGCCACACAGACCCCCGGG No data
Right 1123110480 14:105864782-105864804 AGGGAGGGGTGACGTTCCCAGGG No data
1123110462_1123110484 27 Left 1123110462 14:105864746-105864768 CCCCAGCCACACAGACCCCCGGG No data
Right 1123110484 14:105864796-105864818 TTCCCAGGGAGACGGTGGCCGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1123110462 Original CRISPR CCCGGGGGTCTGTGTGGCTG GGG (reversed) Intergenic