ID: 1123110466

View in Genome Browser
Species Human (GRCh38)
Location 14:105864752-105864774
Sequence TCTCAGCCCGGGGGTCTGTG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 10 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1123110466_1123110482 16 Left 1123110466 14:105864752-105864774 CCACACAGACCCCCGGGCTGAGA No data
Right 1123110482 14:105864791-105864813 TGACGTTCCCAGGGAGACGGTGG No data
1123110466_1123110483 20 Left 1123110466 14:105864752-105864774 CCACACAGACCCCCGGGCTGAGA No data
Right 1123110483 14:105864795-105864817 GTTCCCAGGGAGACGGTGGCCGG No data
1123110466_1123110481 13 Left 1123110466 14:105864752-105864774 CCACACAGACCCCCGGGCTGAGA No data
Right 1123110481 14:105864788-105864810 GGGTGACGTTCCCAGGGAGACGG No data
1123110466_1123110475 -8 Left 1123110466 14:105864752-105864774 CCACACAGACCCCCGGGCTGAGA No data
Right 1123110475 14:105864767-105864789 GGCTGAGACCCAGGCAGGGAGGG No data
1123110466_1123110484 21 Left 1123110466 14:105864752-105864774 CCACACAGACCCCCGGGCTGAGA No data
Right 1123110484 14:105864796-105864818 TTCCCAGGGAGACGGTGGCCGGG No data
1123110466_1123110480 7 Left 1123110466 14:105864752-105864774 CCACACAGACCCCCGGGCTGAGA No data
Right 1123110480 14:105864782-105864804 AGGGAGGGGTGACGTTCCCAGGG No data
1123110466_1123110479 6 Left 1123110466 14:105864752-105864774 CCACACAGACCCCCGGGCTGAGA No data
Right 1123110479 14:105864781-105864803 CAGGGAGGGGTGACGTTCCCAGG No data
1123110466_1123110487 30 Left 1123110466 14:105864752-105864774 CCACACAGACCCCCGGGCTGAGA No data
Right 1123110487 14:105864805-105864827 AGACGGTGGCCGGGCTGCCCTGG No data
1123110466_1123110476 -7 Left 1123110466 14:105864752-105864774 CCACACAGACCCCCGGGCTGAGA No data
Right 1123110476 14:105864768-105864790 GCTGAGACCCAGGCAGGGAGGGG No data
1123110466_1123110474 -9 Left 1123110466 14:105864752-105864774 CCACACAGACCCCCGGGCTGAGA No data
Right 1123110474 14:105864766-105864788 GGGCTGAGACCCAGGCAGGGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1123110466 Original CRISPR TCTCAGCCCGGGGGTCTGTG TGG (reversed) Intergenic