ID: 1123110467

View in Genome Browser
Species Human (GRCh38)
Location 14:105864758-105864780
Sequence AGACCCCCGGGCTGAGACCC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1123110455_1123110467 24 Left 1123110455 14:105864711-105864733 CCCAAGCACAGAGCAGAGGCAGC No data
Right 1123110467 14:105864758-105864780 AGACCCCCGGGCTGAGACCCAGG No data
1123110459_1123110467 -5 Left 1123110459 14:105864740-105864762 CCCTGTCCCCAGCCACACAGACC No data
Right 1123110467 14:105864758-105864780 AGACCCCCGGGCTGAGACCCAGG No data
1123110456_1123110467 23 Left 1123110456 14:105864712-105864734 CCAAGCACAGAGCAGAGGCAGCC No data
Right 1123110467 14:105864758-105864780 AGACCCCCGGGCTGAGACCCAGG No data
1123110458_1123110467 2 Left 1123110458 14:105864733-105864755 CCGGCGTCCCTGTCCCCAGCCAC No data
Right 1123110467 14:105864758-105864780 AGACCCCCGGGCTGAGACCCAGG No data
1123110460_1123110467 -6 Left 1123110460 14:105864741-105864763 CCTGTCCCCAGCCACACAGACCC No data
Right 1123110467 14:105864758-105864780 AGACCCCCGGGCTGAGACCCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1123110467 Original CRISPR AGACCCCCGGGCTGAGACCC AGG Intergenic